|
Homopolymer read lengths |
|||
| Homopolymer |
Read direction |
||
| Length |
Forward |
Reverse |
Total |
|
|
|||
| 8 |
2 |
6 |
8 |
| 9 |
10 |
22 |
32 |
| 10 |
12 |
20 |
32 |
| 11 |
1 |
6 |
7 |
|
Read lengths in the 454 data for the GpSGHV sequence starting at position 86587, TTTT*AAAA*TTAAAAAAAAATCCTCCGAGT | |||
Parker and Parker Source Code for Biology and Medicine 2008 3:5 doi:10.1186/1751-0473-3-5 |
|||